Sample collection

Samples of fresh liquorice (G. uralensis) were collected from Gansu province (N 38°38’18’’, E 103°05’25’’, permitted by The Forestry Department of Gansu province), Ningxia province (N 37°46’55’’, E 107°24’18’’, permitted by The Forestry Department of Ningxia province) and Xinjiang province (N 42°17’59’’, E 86°24’18’’, permitted by The Forestry Department of Xinjiang province) in China. Twenty to 30 healthy wild liquorice roots were dug out carefully at each site and were gently shaken to remove superficial soil. Cleaned roots were then placed into sterile paper bags. Dry liquorice roots were collected from relevant local markets in Gansu, Ningxia and Xinjiang province. For each site, about 1 kg roots were collected from 5 different herbal stores and put into sterile paper bags. Samples from Gansu and Ningxia were whole dry roots which were dried in the sun at each respective locality while those from Xinjiang were herbal slices of roots, which were made from whole dry roots in the local processing factory. The temperatures of each sampling sites were 21.7°C, 20.0 °C, 17.1°C, and relative humidity 14%, 13%, 15% in Gansu, Ningxia and Xinjiang, respectively. All paper bags containing liquorice samples were transported to the lab in Beijing within 3 days of collection.

Isolation of fungi

Entire liquorice roots were cut into pieces with sterile scissors; herbal slices of roots were directly used for fungal isolation. Ten g of each sample was added to 90 ml sterile water and mixed. This mixture was then shaken on a rotary shaker for approximately 30 min and subjected to a series of ten-fold serial dilution to a final concentration of 10^-3. Aliquots consisting of 1 ml of each dilution were spread (in quadruplicate) on Rose Bengal Chloramphenicol Agar (RBCA). One of the three sets of dilutions that averaged between 10 and 60 colonies per plate was selected for enumeration. The results of quadruplicate plating were expressed as the average CFU/g. All of the plates were incubated at 25 °C for 7 to 10 days and were subsequently stored at 4 °C for future colony isolation and identification.

Identification of fungi

Followed by preliminary morphological identification, every fungal colony was transferred and re-streaked onto Malt Extract Agar (MEA). With respect to new Penicillium species, colonies on Czapek Yeast Autolysate Agar (CYA) and Yeast Extract Sucrose Agar (YES) cultivated at 25 °C for 7 days were also compared and described. Colony colour was assessed according to The Methuen Handbook of Colour by Kornerup and Wanscher [22]. Other macroscopical and microscopic morphological observations (eg. colony texture, conidiophore and conidia characteristics) were made according to proper guides [23-26]. To verify the results of morphological characterization and identification of fungi, the β-tubulin gene and the second largest RNA polymerase II subunit (RPBII) gene were PCR amplified and sequenced. In total, 126 isolates affiliated with Aspergillus and Penicillium were subjected to PCR amplification of the β-tubulin gene using the primer pair Bt2a 5'-GGTAACCAAATCGGTGCTGCTTTC-3' and Bt2b 5'-ACCCTCA GTGTAG TGACCCTTGGC-3' [27]. A part of RPBII gene were amplified from these strains with the primer pair RPB2-5F_Pc 5’- GATGACCGTGACCACTTCGG-3’ and RPB2-7CR_Pc 7CR 5’-CCCATGGCTTGTTTGCCCAT-3’ [28]. With respect to fungal species other than Penicillium and Aspergillus spp., ITS gene was amplified by using the primers ITS4 5'- TCCTCCGCTTATTGATATGC -3' and ITS5 5'- GGAAGTAAAAGTCGTAACAAGG -3' [29]. Basic Local Alignment Search Tool (BLAST) was used to identify the closest affiliated sequence in the GenBank/NCBI dataset.

Phylogenetic tree construction

Phylogenetic analyses were conducted in order to better understand the evolutionary history of isolates using the obtained partial β-tubulin and RPBII genes. Sequences of selected strains along with reference sequences obtained from GenBank (Table 1) were aligned using Clustal X [30]. Alignment was manually trimmed at the N and C terminals to delete non-overlapping alignment regions with the MEGA5 program [31]. Phylogenetic analyses using the neighbor-joining method [32] was performed with the same program. The neighbor-joining tree was constructed specifying 1) the Kimura 2-parameter model, 2) transitions and transversions and 3) with pairwise deletion of gaps. The phylogeny was subjected to 1000 bootstrap replicates. All phylograms were rooted with gene sequences from A. westerdijkiae.

Nomenclature

The electronic version of this article in Portable Document Format (PDF) in a work with an ISSN or ISBN will represent a published work according to the International Code of Nomenclature for algae, fungi, and plants, and hence the new names contained in the electronic publication of a PLOS ONE article are effectively published under that Code from the electronic edition alone, so there is no longer any need to provide printed copies. In addition, new names contained in this work have been submitted to MycoBank from where they will be made available to the Global Names Index. The unique MycoBank number MB804682 and MB804683 can be resolved and the associated information viewed through any standard web browser by appending the MycoBank number contained in this publication to the prefix http://www.mycobank.org/MB/. The online version of this work is archived and available from the following digital repositories: PubMed Central, LOCKSS etc.

OTA and AFB1 determination of fungal strains by liquid chromatography/mass spectrometry/mass spectrometry (LC/MS/MS)

Fungal strains were grown on sterile rice media (20 g rice; 20 ml water, sterilize for 30 min) for 30 days at 25 °C. After incubation, all cultures were treated at 60 °C for three days to dry the mycelial mat and then finely grounded using a grinder. About 20 g mat material and 100 ml methanol-water (80/20) was mixted and extracted using ultrasonography for 45 min and filtered. The filtrate was purified by solid phase extraction (SPE) (NERCB-SPE, 100 mg/3 ml, Beijing, China). LC/MS/MS analysis was performed with an Agilent 1200 series high-performance liquid chromatograph (HPLC) (Palo Alto, CA, USA) interfaced to a 3200Q Trap triple-quadrupole linear ion-trap MS/MS system (Applied Biosystems, Foster City, CA, USA). The sample was separated using a XbridgeTM C18 column (150 × 2.1 mm, 3.5 µm) (Waters, Milford, Massachusetts, USA) with acetonitrile- water containing 5 mM ammonium acetate. OTA and AFB1 were detected with ESI in positive mode. The collision energy (CE) was 40.0 V. The MRM model was used for quantitative calculation. The ion pairs at m/z 404/358 and m/z 313/285 were employed to analyze OTA and AFB1, respectively. The limits of detection (LOD) and the limits of quantification (LOQ) were less than 0.024 and 0.095 µg/kg, respectively [33].

Statistical analysis

Isolation frequency was determined as the number of isolates of one species divided by the total number of isolates obtained. The species diversity was estimated using the Shannon-Wiener index (H´) according to the formula: $H\text{'}\text{=-}\sum _{i=1}^n{P}_{i}1n{P}_i$[34], where P_i is the proportion of the ith species and n is the number of species at the site. The Bray-Curtis similarity coefficient (C) was used to estimate the similarity of fungal communities as C = 2w/(a+b) [35], where w is the sum of the lesser counts of each species common to both sites, a and b were the sum of all isolates obtained in each site.

The software SPSS 15.0 was used for the statistical data analysis. Analyses were made of fungal colony counts of different regions by standard χ² tests. Multiple pairwise comparisons were performed using the Table procedure of SPSS software and the Bonferroni method was used to adjust P-values.

Phylogeny and Taxonomy of Fungal Species

All fungal strains were identified according to morphological and molecular characteristics. With respect to confusing species and potential toxigenic species, twelve β-tubulin and 15 RPBII sequences were included in the analysis. In addition, forty-one and 32 sequences recovered from GenBank that were associated with Penicillium subgenus Penicillium sect. Viridicata and sect. Chrysogena, respectively, were included as references. Figure 1 indicates that members of the sect. Viridicata and Chrysogena formed two separate clades. Penicillium polonicum strain CGMCC3.15272 (G5314) clustered with type species CBS 222.28. Penicillium polonicum strain CGMCC3.15264 (G3323) was excluded from this clade, but subsequent morphological observations (blue green conidia on CYA and YES) suggests that it should be included in this lineage. In clade Chrysogena, described P. chrysogenum strains formed an independent lineage that clustered with type species CBS 306.48. Two new branches were separated from other known species with rather high bootstrap value. Combined with detailed morphological observation, they were identified as two new species, namely Penicillium glycyrrhizacola sp. nov. and Penicillium xingjiangense sp. nov.. The phylogenetic position of isolates when the RPBII sequence was used is in full agreement with that when β-tubulin sequence was used. (Figure 2)

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Neighbor-joining tree inferred from partial β-tubulin genes showing the relationships among members of Penicillium subgenus Penicillium sect.

Viridicata and sect. Chrysogena. The tree is rooted with the β -tubulin gene from Aspergillus westerdijkiae.

https://doi.org/10.1371/journal.pone.0078285.g001

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Neighbor-joining tree inferred from partial RPBII genes showing the relationships among members of Penicillium subgenus Penicillium sect.

Viridicata and sect. Chrysogena. The tree is rooted with the RPBII gene from Aspergillus westerdijkiae.

https://doi.org/10.1371/journal.pone.0078285.g002

Penicillium glycyrrhizacola Chen, Sun & Gao, sp. nov. Figure 3.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Penicillium glycyrrhizacola sp. nov. A-C. 7-day old colonies on A. CYA, B. MEA, C. YES, D-F.

Conidiophores. G. Conidia. Scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0078285.g003

Mycobank no.: MB804682

Colonies on CYA at 25°C reaching 23-34 mm diam. in 7 d, floccose, radially furrowed; mycelium white to grayish green (25B3), exudates rarely present, clear, reverse grayish yellow (33C) to white at center.

Colonies on MEA at 25°C reaching 23-34 mm diam. in 7 d, floccose to velutinous; mycelium grayish green (25B3); sporulation heavy on entire surface of colonies, reverse white.

Colonies on YES at 25°C reaching 31-38 mm diam. in 7 d, velvety, crater-like or convoluted at center, radially furrowed, mycelium white to grayish green (25C3), reverse grayish yellow (33C) to white.

Conidiophores borne from surface or subsurface hyphae, stipes commonly 150-300 ×2.5-3.5 µm, ter- and quarter verticillate, divergent rami born from aerial and subsurface hyphae; rami 13-20×3.0-4.0 µm; metulae in verticals of 3-5, short and appressed, 9-12×2.5-3.5 µm, phialides 4-7 per vertical, ampilliform 8-10×2.5-3 µm. Conidia ellipsoidal to subspheroidal, smooth walled, 2.2-2.6 × 2.5-3.2 µm.

Habitat: Liquorice, China

Holotype: China, Gansu, from liquorice, CGMCC3.15271 (G4432), specimen deposited in Herbarium Mycologicum Academiae Sinicae HMAS 244707; Paratype: China, Xingjiang, from liquorice, CGMCC3.15273 (74212), HMAS 244708.

Distinguishing characteristics: Penicillium glycyrrhizacola shares many characters in common with P. chrysogenum, but differs by the grayish green colony on CYA and MEA, rarely present clear exudates and absent soluble pigment.

Penicillium xingjiangense Chen, Sun & Gao, sp. nov. Figure 4.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Penicillium xingjiangense sp. nov. A-C. 7-day old colonies on A. CYA, B. MEA, C. YES, D-F.

Conidiophores. G. Conidia. Scale bar = 10 µm.

https://doi.org/10.1371/journal.pone.0078285.g004

Mycobank no.: MB804683

Colonies on CYA at 25°C reaching 29-32 mm diam. in 7 d, floccose, radially furrowed; mycelium white to pale yellow (4A3), exudates clear, reverse grayish yellow (3C3).

Colonies on MEA at 25°C reaching 20-24 mm diam. in 7 d, floccose to velutinous; mycelium grayish green (4B3) at centre, turquoise white (24A2) towards white at margin; sporulation heavy on entire surface of colonies, reverse white.

Colonies on YES at 25°C reaching 39-45 mm diam. in 7 d, velvety, radially furrowed, mycelium orange grey (6B2), reverse pale yellow (1A3).

Conidiophores borne from surface or subsurface hyphae, stipes commonly 100-300 ×3.0-3.2 µm, ter- and quarter verticillate, divergent rami born from aerial and subsurface hyphae; rami 21-30×3.0-3.2 µm; metulae in verticals of 2-5, thin and appressed, 9-13×2.0-3.0 µm, phialides 5-7 per vertical, ampilliform 8-10×2-3 µm. Conidia mostly globose, smooth walled, 2.0-2.2 × 2.8-3.2 µm.

Habitat: Liquorice, China

Holotype: China, Xingjiang, from liquorice, CGMCC3.15274 (84513), specimen deposited in Herbarium Mycologicum Academiae Sinicae, HMAS 244709.

Distinguishing characteristics: Penicillium xingjiangense is closely relate to P. confertum and P. mononematosum, but differs by the white to pale yellow colony on CYA and thin metulae.

Comparison of fungal community on fresh and dry liquorice

Total fungal counts ranged from 300 to 3400 CFU/g on fresh liquorice sampled from 3 production areas; nineteen species of fungi belonging to 8 genera were detected among these CFUs (Table 2). The fungal community associated with fresh liquorice showed high species diversity with the Shannon-Weiner index (H’) of 1.971. Penicillium and Aspergillus were the two most predominant genera detected in association with fresh liquorice, representing 49.57% and 24.98% of the total CFUs respectively. Penicillium glycyrrhizacola, P. chrysogenum and A. insuetus were the most common species on fresh liquorice from Gansu, Ningxia and Xinjiang province; Penicillium chrysogenum was the only species which was detected from all three of the production areas. In contrast, a total of 2200 to 9375 CFU were obtained per g dry liquorice. Among these CFUs, ten species belonging to 4 genera were detected. The fungal community associated with dry liquorice showed low species diversity as evinced by a Shannon-Weiner index (H’) as 1.755 when compared to 1.971 associated with the fresh liquorice. Like fresh liquorice, Penicillium and Aspergillus were the two most abundant genera detected, representing 73.54% and 14.26% of the CFUs. P. chrysogenum was the most common species on dry liquorice from Gansu and could be detected in both Ningxia and Xinjiang samples while with relative low frequency. Seven fungal species could be detected in association with both fresh and dry liquorice which including A. westerdijkiae, Eurotium amstelodami, Penicillium aurantiogriseum, P. chrysogenum, P. crustosum, P. glycyrrhizacola and P. polonicum. The similarity of fungal communities between fresh and dry liquorice was 22% (Bray-Curtis index). Among the three production areas examined, the most similar dry and fresh liquorice fungal communities were found in Gansu, with a Bray-Curtis index of 31.78%, followed by Ningxia (Bray-Curtis index = 6.67%) and Xinjiang (Bray-Curtis index = 4.46%).

OTA and AFB1 production by selected strains

Among the 21 fungal species obtained in this study, 5 species (P. polonicum, P. chrysogenum, P. crustosum, A. ochraceus and A. westerdijkiae) were classified as potentially being toxigenic [16–18,21]. Accordingly, 21 strains belonging to these five species and 2 new species P. glycyrrhizacola and P. xingjiangense were screened for OTA and AFB1 production. OTA could be detected in 6 strains belong to 5 species (Table 3). A chromatogram with the mass spectrum from an OTA positive sample is depicted in Figure 5. As shown in Table 3, P. chrysogenum, P. glycyrrhizacola, P. polonicum, A. ochraceus and A. westerdijkiae could produce OTA. The OTA concentration varied among the isolates from 12.99 to 39.03 µg/kg. AFB1 was absent in all tested strains.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. LC-MS/MS chromatography for OTA positive strain CGMCC3.15268 (84424) with Q1 mode.

Ions at m/z 404 and m/z 358 were selected as characteristic signals of OTA, while the ion at m/z 406 containing ³⁷Cl was a reference.

https://doi.org/10.1371/journal.pone.0078285.g005