NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance
Abstract
:1. Introduction
2. Materials ad Methods
2.1. Tissue Microarray
2.2. Immunohistochemistry (IHC)
2.3. Scoring
2.4. Materials
2.5. Cell Culture
2.6. Antibodies
2.7. shNGAL Knockdown
2.8. Cell Viability
2.9. Cell Cycle Analysis
2.10. Cell Survival Assay
2.11. In Vitro Wound Closure Assay
2.12. Cell Invasion and Migration Assay
2.13. RNA Isolation and Reverse Transcriptase PCR
2.14. Western Blot Analysis
2.15. Propidium Iodide Flow Cytometry (PI/FACS)
2.16. Statistical Analysis
3. Results
3.1. NGAL Expression Was Found to Be Downregulated in Oral Cancer
3.2. Tobacco Components Downregulated the Expression of NGAL
3.3. Silencing of NGAL Increased Proliferation and Survival of Oral Cancer Cells
3.4. Silencing of NGAL Increases Invasion and Migration of Oral Cancer Cells
3.5. Silencing of NGAL Activates mTOR Signalling and Suppresses Autophagy
3.6. Silencing of NGAL Selectively Induces Resistance Against Cisplatin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Ferlay, J.; Soerjomataram, I.; Ervik, M.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Globocan 2012 v1.0, Cancer Incidence and Mortality Worldwide; IARC CancerBase. No. 11; International Agency for Research on Cancer: Lyon, France, 2016. [Google Scholar]
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin. 2011, 61, 69–90. [Google Scholar] [CrossRef] [PubMed]
- Seer Cancer Stat Facts: Oral Cavity and Pharynx Cancer. Available online: http://seer.Cancer.gov/statfacts/html/oralcav.html (accessed on 24 December 2017).
- Van Wolfswinkel, M.E.; Koopmans, L.C.; Hesselink, D.A.; Hoorn, E.J.; Koelewijn, R.; van Hellemond, J.J.; van Genderen, P.J. Neutrophil gelatinase-associated lipocalin (NGAL) predicts the occurrence of malaria-induced acute kidney injury. Malar. J. 2016, 15, 464. [Google Scholar] [CrossRef] [PubMed]
- Devarajan, P. Neutrophil gelatinase-associated lipocalin: A promising biomarker for human acute kidney injury. Biomark. Med. 2010, 4, 265–280. [Google Scholar] [CrossRef] [PubMed]
- Cruz, D.N.; Gaiao, S.; Maisel, A.; Ronco, C.; Devarajan, P. Neutrophil gelatinase-associated lipocalin as a biomarker of cardiovascular disease: A systematic review. Clin. Chem. Lab. Med. 2012, 50, 1533–1545. [Google Scholar] [CrossRef] [PubMed]
- Roli, L.; Pecoraro, V.; Trenti, T. Can NGAL be employed as prognostic and diagnostic biomarker in human cancers? A systematic review of current evidence. Int. J. Biol. Mark. 2017, 32, e53–e61. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zeng, T. Neutrophil gelatinase-associated lipocalin protein as a biomarker in the diagnosis of breast cancer: A meta-analysis. Biomed. Rep. 2013, 1, 479–483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monisha, J.; Padmavathi, G.; Bordoloi, D.; Roy, N.K.; Kunnumakkara, A.B. Neutrophil gelatinase-associated lipocalin (NGAL): A promising biomarker for cancer diagnosis and a potential target for cancer therapeutics. J. Cell Sci. Mol. Biol. 2014, 1, 106. [Google Scholar]
- Candido, S.; Maestro, R.; Polesel, J.; Catania, A.; Maira, F.; Signorelli, S.S.; McCubrey, J.A.; Libra, M. Roles of neutrophil gelatinase-associated lipocalin (NGAL) in human cancer. Oncotarget 2014, 5, 1576–1594. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Li, J.; Li, S.; Li, J.; Yu, C.; Wei, C. Effect of inhibiting NGAL gene expression on a549 lung cancer cell migration and invasion. Zhongguo Fei Ai Za Zhi 2015, 18, 187–192. [Google Scholar] [PubMed]
- Wang, P.H.; Ko, J.L.; Yang, S.F.; Lin, L.Y. Implication of human nonmetastatic clone 23 type 1 and its downstream gene lipocalin 2 in metastasis and patient’s survival of cancer of uterine cervix. Int. J. Cancer 2011, 129, 2380–2389. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Zhang, H.; Jiang, L.; Chi, Y.; Tian, J.; Du, W.; Yu, B.; Han, Z. Down-regulation of lipocalin 2 suppresses the growth of human lung adenocarcinoma through oxidative stress involving nrf2/ho-1 signaling. Acta Biochim. Biophys. Sin. (Shanghai) 2015, 47, 805–814. [Google Scholar] [CrossRef] [PubMed]
- Chung, I.H.; Wu, T.I.; Liao, C.J.; Hu, J.Y.; Lin, Y.H.; Tai, P.J.; Lai, C.H.; Lin, K.H. Overexpression of lipocalin 2 in human cervical cancer enhances tumor invasion. Oncotarget 2016, 7, 11113–11126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mongre, R.K.; Sodhi, S.S.; Sharma, N.; Ghosh, M.; Kim, J.H.; Kim, N.; Park, Y.H.; Shin, Y.G.; Kim, S.J.; Jiao, Z.J.; et al. Epigenetic induction of epithelial to mesenchymal transition by LCN2 mediates metastasis and tumorigenesis, which is abrogated by NF-κB inhibitor BRM270 in a xenograft model of lung adenocarcinoma. Int. J. Oncol. 2016, 48, 84–98. [Google Scholar] [CrossRef] [PubMed]
- Leung, L.; Radulovich, N.; Zhu, C.Q.; Organ, S.; Bandarchi, B.; Pintilie, M.; To, C.; Panchal, D.; Tsao, M.S. Lipocalin 2 promotes invasion, tumorigenicity and gemcitabine resistance in pancreatic ductal adenocarcinoma. PLoS ONE 2012, 7, e46677. [Google Scholar] [CrossRef] [PubMed]
- Hiromoto, T.; Noguchi, K.; Yamamura, M.; Zushi, Y.; Segawa, E.; Takaoka, K.; Moridera, K.; Kishimoto, H.; Urade, M. Up-regulation of neutrophil gelatinase-associated lipocalin in oral squamous cell carcinoma: Relation to cell differentiation. Oncol. Rep. 2011, 26, 1415–1421. [Google Scholar] [PubMed]
- Lin, C.W.; Yang, W.E.; Lee, W.J.; Hua, K.T.; Hsieh, F.K.; Hsiao, M.; Chen, C.C.; Chow, J.M.; Chen, M.K.; Yang, S.F.; et al. Lipocalin 2 prevents oral cancer metastasis through carbonic anhydrase ix inhibition and is associated with favourable prognosis. Carcinogenesis 2016, 37, 712–722. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- One-Way ANOVA (ANalysis Of VAriance) with Post-Hoc Tukey HSD (Honestly Significant Difference) Test Calculator for Comparing Multiple Treatments. Available online: http://astatsa.com/OneWay_Anova_with_TukeyHSD/ (accessed on 26 June 2018).
- Kumar, M.; Nanavati, R.; Modi, T.G.; Dobariya, C. Oral cancer: Etiology and risk factors: A review. J. Cancer Res. Ther. 2016, 12, 458–463. [Google Scholar] [CrossRef] [PubMed]
- Pópulo, H.; Lopes, J.M.; Soares, P. The mTOR signalling pathway in human cancer. Int. J. Mol. Sci. 2012, 13, 1886–1918. [Google Scholar] [CrossRef] [PubMed]
- Ramos-García, P.; Gil-Montoya, J.A.; Scully, C.; Ayén, A.; González-Ruiz, L.; Navarro-Triviño, F.J.; González-Moles, M.A. An update on the implications of cyclin D1 in oral carcinogenesis. Oral Dis. 2017, 23, 897–912. [Google Scholar] [CrossRef] [PubMed]
- Dowling, R.J.; Zakikhani, M.; Fantus, I.G.; Pollak, M.; Sonenberg, N. Metformin inhibits mammalian target of rapamycin-dependent translation initiation in breast cancer cells. Cancer Res. 2007, 67, 10804–10812. [Google Scholar] [CrossRef] [PubMed]
- Shackelford, D.B.; Shaw, R.J. The lκB1-AMPK pathway: Metabolism and growth control in tumour suppression. Nat. Rev. Cancer 2009, 9, 563–575. [Google Scholar] [CrossRef] [PubMed]
- Ellisen, L.W.; Ramsayer, K.D.; Johannessen, C.M.; Yang, A.; Beppu, H.; Minda, K.; Oliner, J.D.; McKeon, F.; Haber, D.A. REDD1, a developmentally regulated transcriptional target of p63 and p53, links p63 to regulation of reactive oxygen species. Mol. Cell 2002, 10, 995–1005. [Google Scholar] [CrossRef]
- Schneider, A.; Younis, R.H.; Gutkind, J.S. Hypoxia-induced energy stress inhibits the mTOR pathway by activating an AMPK/REDD1 signaling axis in head and neck squamous cell carcinoma. Neoplasia 2008, 10, 1295–1302. [Google Scholar] [CrossRef] [PubMed]
- He, G.; Zhang, Y.W.; Lee, J.H.; Zeng, S.X.; Wang, Y.V.; Luo, Z.; Dong, X.C.; Viollet, B.; Wahl, G.M.; Lu, H. AMP-activated protein kinase induces p53 by phosphorylating MDMX and inhibiting its activity. Mol. Cell. Biol. 2014, 34, 148–157. [Google Scholar] [CrossRef] [PubMed]
- Vadysirisack, D.D.; Baenke, F.; Ory, B.; Lei, K.; Ellisen, L.W. Feedback control of p53 translation by REDD1 and mTORc1 limits the p53-dependent DNA damage response. Mol. Cell. Biol. 2011, 31, 4356–4365. [Google Scholar] [CrossRef] [PubMed]
- Yang, P.; Ling, L.; Sun, W.; Yang, J.; Zhang, L.; Chang, G.; Guo, J.; Sun, J.; Sun, L.; Lu, D. Ginsenoside rg1 inhibits apoptosis by increasing autophagy via the AMPK/mTOR signaling in serum deprivation macrophages. Acta Biochim. Biophys. Sin. (Shanghai) 2018, 50, 144–155. [Google Scholar] [CrossRef] [PubMed]
- Dunlop, E.A.; Tee, A.R. mTOR and autophagy: A dynamic relationship governed by nutrients and energy. Semin. Cell Dev. Biol. 2014, 36, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Li, J.Z.; Chan, J.Y.; Ho, W.K.; Wong, T.S. mTOR pathway and mTOR inhibitors in head and neck cancer. ISRN Otolaryngol. 2012, 2012, 953089. [Google Scholar] [CrossRef] [PubMed]
- Sturla, S.J.; Scott, J.; Lao, Y.; Hecht, S.S.; Villalta, P.W. Mass spectrometric analysis of relative levels of pyridyloxobutylation adducts formed in the reaction of DNA with a chemically activated form of the tobacco-specific carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone. Chem. Res. Toxicol. 2005, 18, 1048–1055. [Google Scholar] [CrossRef] [PubMed]
- Kiyohara, C.; Yoshimasu, K.; Takayama, K.; Nakanishi, Y. NQO1, MPO, and the risk of lung cancer: A huge review. Genet. Med. 2005, 7, 463–478. [Google Scholar] [CrossRef] [PubMed]
- Kiyohara, C.; Yoshimasu, K.; Takayama, K.; Nakanishi, Y. EPHX1 polymorphisms and the risk of lung cancer: A huge review. Epidemiology 2006, 17, 89–99. [Google Scholar] [CrossRef] [PubMed]
- Hecht, S.S.; Carmella, S.G.; Kenney, P.M.; Low, S.H.; Arakawa, K.; Yu, M.C. Effects of cruciferous vegetable consumption on urinary metabolites of the tobacco-specific lung carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in singapore chinese. Cancer Epidemiol. Biomark. Prev. 2004, 13, 997–1004. [Google Scholar]
- Xue, J.; Yang, S.; Seng, S. Mechanisms of cancer induction by tobacco-specific NNK and NNN. Cancers 2014, 6, 1138–1156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanojia, D.; Vaidya, M.M. 4-nitroquinoline-1-oxide induced experimental oral carcinogenesis. Oral Oncol. 2006, 42, 655–667. [Google Scholar] [CrossRef] [PubMed]
- Martínez, C.A.R. 4NQO carcinogenesis: A model of oral squamous cell carcinoma. Int. J. Morphol. 2012, 30, 309–314. [Google Scholar] [CrossRef]
- Kim, S.L.; Lee, S.T.; Min, I.S.; Park, Y.R.; Lee, J.H.; Kim, D.G.; Kim, S.W. Lipocalin 2 negatively regulates cell proliferation and epithelial to mesenchymal transition through changing metabolic gene expression in colorectal cancer. Cancer Sci. 2017, 108, 2176–2186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hay, N.; Sonenberg, N. Upstream and downstream of mTOR. Genes Dev. 2004, 18, 1926–1945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monteiro, L.S.; Delgado, M.L.; Ricardo, S.; Garcez, F.; do Amaral, B.; Warnakulasuriya, S.; Lopes, C. Phosphorylated mammalian target of rapamycin is associated with an adverse outcome in oral squamous cell carcinoma. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2013, 115, 638–645. [Google Scholar] [CrossRef] [PubMed]
- Hirashima, K.; Baba, Y.; Watanabe, M.; Karashima, R.; Sato, N.; Imamura, Y.; Hiyoshi, Y.; Nagai, Y.; Hayashi, N.; Iyama, K.; et al. Phosphorylated mTOR expression is associated with poor prognosis for patients with esophageal squamous cell carcinoma. Ann. Surg. Oncol. 2010, 17, 2486–2493. [Google Scholar] [CrossRef] [PubMed]
- Bakarakos, P.; Theohari, I.; Nomikos, A.; Mylona, E.; Papadimitriou, C.; Dimopoulos, A.M.; Nakopoulou, L. Immunohistochemical study of PTEN and phosphorylated mTOR proteins in familial and sporadic invasive breast carcinomas. Histopathology 2010, 56, 876–882. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.Z.; Geng, Q.R.; Tian, Y.; Cai, M.Y.; Fang, X.J.; Zhan, Y.Q.; Zhou, Z.W.; Li, W.; Chen, Y.B.; Sun, X.W.; et al. Activated mammalian target of rapamycin is a potential therapeutic target in gastric cancer. BMC Cancer 2010, 10, 536. [Google Scholar] [CrossRef] [PubMed]
- Chaisuparat, R.; Rojanawatsirivej, S.; Yodsanga, S. Ribosomal protein S6 phosphorylation is associated with epithelial dysplasia and squamous cell carcinoma of the oral cavity. Pathol. Oncol. Res. 2013, 19, 189–193. [Google Scholar] [CrossRef] [PubMed]
- Laplante, M.; Sabatini, D.M. mTOR signaling in growth control and disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.X.; Xu, Z.X. Targeting the lkb1 tumor suppressor. Curr. Drug Targets 2014, 15, 32–52. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Garcia, O.; Olmer, M.; Akagi, R.; Akasaki, Y.; Fisch, K.M.; Shen, T.; Su, A.I.; Lotz, M.K. Suppression of REDD1 in osteoarthritis cartilage, a novel mechanism for dysregulated mTOR signaling and defective autophagy. Osteoarthr. Cartil. 2016, 24, 1639–1647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, P.H.; Yang, S.F.; Tseng, C.J.; Ying, T.H.; Ko, J.L.; Lin, L.Y. The role of lipocalin 2 and its concernment with human nonmetastatic clone 23 type 1 and p53 in carcinogenesis of uterine cervix. Reprod. Sci. 2011, 18, 447–455. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, T.; Kashima, H.; Yamada, Y.; Kobara, H.; Asaka, R.; Ando, H.; Higuchi, S.; Ida, K.; Mvunta, D.H.; Shiozawa, T. Lipocalin 2 enhances migration and resistance against cisplatin in endometrial carcinoma cells. PLoS ONE 2016, 11, e0155220. [Google Scholar] [CrossRef] [PubMed]
- Rikiishi, H. Autophagic action of new targeting agents in head and neck oncology. Cancer Biol. Ther. 2012, 13, 978–991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
S. No | Clone | Sequence |
---|---|---|
1 | TRCN0000372769 | CCGGCAATTCTCAGAGAAGACAAAGCTCGAGCTTTGTCTTCTCTGAGAATTGTTTTTG |
2 | TRCN0000378896 | CCGGGAGTGGTGAGCACCAACTACACTCGAGTGTAGTTGGTGCTCACCACTCTTTTTG |
3 | TRCN0000372827 | CCGGGGAGCTGACTTCGGAACTAAACTCGAGTTTAGTTCCGAAGTCAGCTCCTTTTTG |
4 | TRCN0000060288 | CCGGGCTGGGCAACATTAAGAGTTACTCGAGTAACTCTTAATGTTGCCCAGCTTTTTG |
5 | TRCN0000060289 | CCGGCCAGCATGCTATGGTGTTCTTCTCGAGAAGAACACCATAGCATGCTGGTTTTTG |
6 | SHC204 | CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTCGGTGAAGATCTTTTT |
Gene | Primers | Tm (°C) | Amplicon Size | |
---|---|---|---|---|
NGAL | F | 5′ATGCCCCTAGGTCTCCTGT3′ | 55 °C | 597 bp |
R | 5′TCAGCCGTCGATACACTG3′ | |||
LKB1 | F | TCAAAATCTCCGACCTGGGC | 55 °C | 570 bp |
R | TGTGACTGGCCTCCTCTTCT | |||
AMPK | F | CGGCAAAGTGAAGGTTGGCAA | 59 °C | 227 bp |
R | CAAATAGCTCTCCTCCTGAGAC | |||
P53 | F | CTGCCCTCAACAAGATGTTTTG | 55 °C | 172 bp |
R | CTATCTGAGCAGCGCTCATGG | |||
Redd1 | F | CTGATGCCTAGCCAGTTGGT | 55 °C | 233 bp |
R | GAGCTAAACAGCCCCTGGAT | |||
GAPDH | F | AGGTCGGAGTCAACGGATTTG | 60 °C | 532 bp |
R | GTGATGGCATGGACTGTGGT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Monisha, J.; Roy, N.K.; Padmavathi, G.; Banik, K.; Bordoloi, D.; Khwairakpam, A.D.; Arfuso, F.; Chinnathambi, A.; Alahmadi, T.A.; Alharbi, S.A.; et al. NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance. Cancers 2018, 10, 228. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers10070228
Monisha J, Roy NK, Padmavathi G, Banik K, Bordoloi D, Khwairakpam AD, Arfuso F, Chinnathambi A, Alahmadi TA, Alharbi SA, et al. NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance. Cancers. 2018; 10(7):228. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers10070228
Chicago/Turabian StyleMonisha, Javadi, Nand Kishor Roy, Ganesan Padmavathi, Kishore Banik, Devivasha Bordoloi, Amrita Devi Khwairakpam, Frank Arfuso, Arunachalam Chinnathambi, Tahani Awad Alahmadi, Sulaiman Ali Alharbi, and et al. 2018. "NGAL is Downregulated in Oral Squamous Cell Carcinoma and Leads to Increased Survival, Proliferation, Migration and Chemoresistance" Cancers 10, no. 7: 228. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers10070228