Next Article in Journal
Recirculation: A New Concept to Drive Innovation in Sustainable Product Design for Bio-Based Products
Previous Article in Journal
Ginsenoside Re Promotes Osteoblast Differentiation in Mouse Osteoblast Precursor MC3T3-E1 Cells and a Zebrafish Model
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm

Key Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou 510642, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Submission received: 28 August 2016 / Revised: 24 December 2016 / Accepted: 26 December 2016 / Published: 29 December 2016
(This article belongs to the Section Bioorganic Chemistry)

Abstract

:
Destruxin A (DA), a cyclodepsipeptidic mycotoxin of entomopathogenic fungus, Metarhizium anisopliae, has anti-immunity activity against insects, but the mechanism of immune regulation is not clear yet. In our previous experiment, the significant expression changes of Bm_nscaf2838_045, Bm_nscaf2674_066, and Bm_nscaf2767_133 genes in a silkworm’s hemocytes were found, which suggested that these genes might be involved in insect’s innate immunity. In the current experiment, the silkworm cell line Bm12 was used to survey the expression levels of these genes after the cells were treated with DA and the transcription factors BmRel, BmRelish1 and BmRelish2 were silenced by specific siRNA. The results indicated that, after the cells were treated by DA, the gene expression level of BmRelish2 was significantly downregulated, but BmRel and BmRelish1 were not changed. The results also showed that the gene expression levels of Bm_nscaf2838_045 and Bm_nscaf2674_066 had similar phenomena, i.e., downregulation with individual BmRelish1 gene silence or DA treatment, upregulation with combination of BmRelish1 gene silence and DA treatment, upregulation with individual BmRelish2 gene silence, and downregulation with combination of BmRelish2 gene silence plus DA treatment, but no changes in the BmRel gene silence combined with DA treatment. For the Bm_nscaf2767_133 gene, the downregulated expressions were found in individual BmRelish2 gene silence or DA treatment, upregulation in the combination treatment of BmRelish2 gene silence plus DA, and the individual treatment of BmRel or BmRelish1 silence. It is suggested that expressions of the Bm_nscaf2838_045 and Bm_nscaf2674_066 genes are closely related to the Imd signal pathway, but Bm_nscaf2767_133 genes might involve in both Toll and Imd pathways. Furthermore, the BmRelish1 gene acts as an activator and the BmRelish2 gene acts as a repressor for both Bm_nscaf2838_045 and Bm_nscaf2674_066 gene expressions. It also implies that DA may participate in the splicing process of BmRelish where BmRelish2 was promoted. Our research will provide new insights on the understanding of the activity mechanisms of destruxins.

1. Introduction

Destruxins are cyclodepsipeptidic mycotoxins with 39 analogues. Destruxin A (DA), the common analogue of entomopathogenic fungus, Metarhizium anisopliae, has substantial insecticidal activity [1,2,3]. Research has shown that DA can destroy an insect’s innate immune system, which includes breaking the balance between calcium ion and hydrogen ion in hemocytes [4], affecting the function of phagocytosis and encapsulation in hemocytes [5] and inhibiting the biosynthesis of the antibacterial peptides in drosophila [6]. Our previous research suggests that, although relatively large doses of DA is required to kill the silkworm (Bombyx mori) Bm12 cell, smaller dosages are sufficient to cause morphological changes [7]. We also found that the expression levels of the Bm_nscaf2838_045 (NCBI GeneBank access NO. KY379951), Bm_nscaf2674_066 (NCBI GeneBank access NO. KY379952), and Bm_nscaf2767_133 (NCBI GeneBank access NO. KY379953) genes in silkworm’s hemocytes were influenced after DA treatment. Analyzing the gene expression profile showed that these genes were characterized as a cuticular protein gene or a basophilic serine protease gene [8]. However, the interaction mechanism of DA with these genes is not clear.
Generally, the Rel/NF-κB signal pathway plays an important role in insect immunization. Toll and Imd pathways belong to the Rel/NF-κB signal pathway. The insect’s immune reaction against fungi and Gram-positive bacteria is activated through the Toll signal pathway and against Gram-negative bacteria through the Imd signal pathway. Rel protein is a downstream transcription factor in the Toll pathway, but Relish protein is a transcription factor of the Imd pathway. The activated transcription factors enter cell nucleus and start to transcribe the target genes of antimicrobial peptides [9,10]. Silkworm has two Rel proteins, namely, Dorsal isoforms A and B, which were respectively coded by BmRelA and BmRelB transcripts from the selectively spliced BmRel gene [11,12]. BmRelish1 and BmRelish2, the two transcripts of the BmRelish genes of B. mori, respectively code two proteins, NF-κB p110 subunit isoforms 1 and 2 [11,12]. However, it is still unclear whether DA influences these transcription factors and how DA interacts with the Bm_nscaf2838_045, Bm_nscaf2674_066, and Bm_nscaf2767_133 genes.
Therefore, in the current experiment, the silkworm cell line Bm12 was used to survey the expression levels of Bm_nscaf2838_045, Bm_nscaf2674_066, and Bm_nscaf2767_133 genes after the cells were treated with DA and the silence of transcription factors BmRelish1, BmRelish2, and BmRel, thereby validating the relations of the three genes with an insect’s immunity system and improving the understand of mechanism of destruxins.

2. Results and Conclusions

2.1. The Gene Expression Levels of Transcription Factors after Treatment by DA and Specific siRNA

The Bm12 cells were transfected by siRNAs. After a treatment of 24 h, it was found that the transcription factors, BmRel, BmRelish1, and BmRelish2 genes were significantly downregulated, and the interference efficiencies (relative expression) were greater than 70% (Figure 1A). Meanwhile, after 8 h of DA treatment, the expression level of the BmRelish2 gene was significantly upregulated, but the BmRelish1 and BmRel genes were basically unchanged (Figure 1B).

2.2. Effects of DA and Silence of BmRel/BmRelish on the Genes Expressions

The results indicated that Bm_nscaf2838_045, Bm_nscaf2674_066, and Bm_nscaf2767_133 genes were all downregulated after 8 h of DA treatment (Figure 2). It was also found that Bm_nscaf2838_045 and Bm_nscaf2674_066 genes were significantly downregulated after the BmRelish1 gene was silenced and were upregulated when BmRelish2 was silenced, but they were not changed after BmRel was silenced (Figure 2A,B). Differently, Bm_nscaf2767_133 gene was significantly downregulated after the BmRelish2 gene was silenced, and was significantly upregulated while BmRel and BmRelish1 genes were silenced (Figure 2C).
Furthermore, when the silence of the BmRelish1 gene and DA treatment were combined, Bm_nscaf2838_045 and Bm_nscaf2674_066 genes were significantly upregulated (Figure 2A,B). On the contrary, when the silence of the BmRelish2 gene and DA treatment were combined, the two genes were all significantly downregulated. However, after the silence of the BmRel gene was combined with DA treatment, the two gene expressions were not statistically different from the control (Figure 2A,B). For the Bm_nscaf2767_133 gene, the expressions were all upregulated in the treatments, except for the silence of BmRelish2 (Figure 2C).

2.3. Discussion

In the current experiment, after 8 h of DA treatment, the expression level of BmRelish2 transcript was significantly upregulated, but the BmRelish1 transcript was basically unchanged. The results suggest that DA probably promotes the formation of the BmRelish2 transcript prior to the BmRelish1 transcript in the mRNA splicing of the BmRelish gene.
Additional data indicated that the expressions of Bm_nscaf2838_045 and Bm_nscaf2674_066 genes were significantly changed after the BmRelish1/2 genes were silenced, respectively, but were not statistically changed when the BmRel gene was silenced. However, the Bm_nscaf2767_133 gene expression in the silencing of the BmRelish1/2 and BmRel genes were all changed. These results suggest the Bm_nscaf2838_045 and Bm_nscaf2674_066 genes are closely related to the Imd signal pathway, but the Bm_nscaf2767_133 gene seems to involve in both the Imd and Toll pathways.
Because silencing BmRelish1 decreased the gene expression levels of Bm_nscaf2838_045 and Bm_nscaf2674_066, but silencing BmRelish2 increased the two gene expressions. It is suggested that BmRelish1 acts as an activator, while BmRelish2 acts as a repressor for both Bm_nscaf2838_045 and Bm_nscaf2674_066 gene expressions.
Furthermore, the expression levels of the Bm_nscaf2838_045 and Bm_nscaf2674_066 genes were improved when BmRelish1 silencing and DA treatment were combined, and both genes were downregulated after BmRelish2 silencing was combined with DA treatment. The results support the hypothesis that DA promotes the formation of the BmRelish2 transcript and that BmRelish1 acts as an activator, while BmRelish2 acts as a repressor for the two gene expressions.
Although the involvement of the three genes in an insect’s immunity was verified in the current study, few of their functions are known. In general, the transcription factors of Rel and Relish regulate the biosynthesis of antimicrobial peptides. However, the three genes do not encode antimicrobial peptides. In fact, from the literatures of gene and protein data banks, there are some information regarding these genes and functions.
The Bm_nscaf2838_045 gene with 546 bp is predicted to encode an actin cytoskeleton-regulatory complex protein PAN1-like [Bombyx mori] through NCBI Blast. This protein contains the PRK15313 CDD and has the functions as a component of the PAN1 actin cytoskeleton-regulatory complex required for the internalization of endosomes during actin-coupled endocytosis. The complex links the site of endocytosis to the cell membrane-associated actin cytoskeleton, mediates uptake of external molecules and vacuolar degradation of plasma membrane proteins, plays a role in the proper organization of the cell membrane-associated actin cytoskeleton, and promotes its destabilization. It is also required for the bipolar budding of diploid cells and the correct distribution of chitin at the cell surface [13,14,15].
The Bm_nscaf2674_066 gene encodes a serine protease (SP). It was found that SPs possess species specificity and 143 SP genes were identified in silkworm [16]. SPs are enzymes that cleave peptide bonds in proteins in which serine serves as the nucleophilic amino acid at the (enzyme’s) active site, so SPs are called serine endopeptidases. They are found ubiquitously in both eukaryotes and prokaryotes with the two broad categories based on their structure: chymotrypsin-like (trypsin-like) or subtilisin-like. SPs have multiple functions including digestion, immune response, blood coagulation, and reproduction [17,18]. SPs are involved in silkworm’s immune response against Escherichia coli, Beauveria bassiana, and the Bombyx mori nuclear polyhydrosis virus. SPs play an important role in the extracellular signal cascade of the immune response associated with the Toll pathway [19].
According to some data, the Bm_nscaf2767_133 gene with 558 bp is predicted to encode a classical arabinogalactan protein 9-like. This protein is usually found in plants and seems to be implicated in diverse developmental roles such as differentiation, cell–cell recognition, embryogenesis, and programmed cell death. The protein contains a domain rich in hydroxyproline/proline, serine, alanine, and glycine amino acids. The protein has repeated glycomodules (Alanine/Serine/Threonine-Proline) and hydroxyproline, which supply the sites for O-linked glycosylation and arabinogalactan modification [20].

3. Materials and Methods

3.1. Cells and Culture

The silkworm Bm12 cell line donated by Professor Cao Yang (College of Animal Science in South China Agricultural University) was cultured with a TNM-FH culture medium (HycloneTM, GE Healthcare, Pittsburgh, PA, USA), and 10% fetal bovine serum (GibcoTM, Thermo Fisher Scientific, Waltham, MA, USA) was added at a constant temperature culture and passage under 27 °C. Over a period of 2–4 days, the cells in logarithmic phase were used for the experiment.

3.2. Destruxin A and Treatment

Destruxin A (DA) was isolated and purified from the Metarhizium anisopliae var. anisopliae strain MaQ10 in the laboratory [21]. DA stock solution of 10,000 μg·mL−1 was made up of 1 mg of DA and 100 μL of dimethyl sulfoxide (DMSO, Sigma-Aldrich, Darmstadt, Germany). When treatment began, the DA stock solution was added into a cell well and maintained a final concentration of DA 200 μg·mL−1. The control group was only supplemented with 0.1% DMSO. The experiments were duplicated three times.

3.3. Gene RNAi Silence

To silence the transcription factor genes—BmRel, BmRelish1, and BmRelish2—RNAi technology was employed. The small interfering RNA (siRNA) sequences were designed according to the 3’ end adjacent nucleotide sequence of the target genes and were synthetized by Invitrogen (Shanghai, China) (Table 1).
For preparation of the siRNA-lipo2000 mixture, two microliter (μL) lipofectimine2000 (Bio-Rad, Hercules, CA, USA) was first diluted with 200 μL of the serum-free TNM-FH culture medium and incubated at room temperature for 5 min. Meanwhile, 2 μL of siRNA was diluted with 200 μL of the serum-free TNM-FH culture medium. Then, the two solutions were mixed and incubated at room temperature for 20 min to form a siRNA-lipofectimine2000 mixture for the cell transfection experiment.
For cell transfection, the Bm12 cells in the Logarithmic phase were moved into 12-well plates (Corning Incorporated, Corning, NY, USA) and cultured with a TNM-FH culture medium. After 24 h, the culture medium was sucked out and supplemented with 100 μL of serum-free medium, which was then gently shaken. Then, 400 μL of siRNA-lipofectimine2000 mixture was added to each well and incubated at 27 °C. After 24 h, the supernatant was washed out, and transfection was terminated. Then, fresh TNM-FH medium containing serum was added, and incubation occurred for 20 h for the combination treatment with DA and a survey of the gene expression. The experiments were replicated three times. The control group was only treated with a 1% (v/v) solution of lipofectimine2000/serum-free TNM-FH culture medium.

3.4. Combination Treatment of Gene RNAi Silence and DA

For combination treatment of gene RNAi with DA, the cell wells treated with siRNA as described in Section 3.3 were supplemented with DA stock solution at a final concentration of 200 μg·mL−1. The control group was only supplemented with 0.1% dimethyl sulfoxide. The experiments were repeated three times.

3.5. Survey of Gene Expression

Real-time quantitative PCR (qPCR) was used to detect the gene expressions. First, total RNA was extracted from the cells treated as described above. The qPCR method refers to the Livak literature [22] and carried out by employing the CFX Connect Real-Time System (BIO-RAD, Shanghai, China). The PCR reaction system was 1 μL of cDNA of reverse transcription, upstream and downstream primers of 1 μL each (Table 2), 10 μL of SYBR Premix Ex TaqTM (Bioscience, Shanghai, China), and 7 μL of ddH2O. The qPCR reactive program was subjected to 39 cycles at 95 °C for 10 s, 60 °C for 10 s, 72 °C for 30 s, then 95 °C for 10 s, and 65–95 °C for 5 s. The experiment was repeated three times. The silkworm GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene was taken as the reference gene.

3.6. Data Analysis

The qPCR data were analyzed by using the 2−ΔΔCt method [23] and calculated according to formula: ΔΔCt = (Ct target gene − Ct housekeeping gene) experimental group − (Cttarget gene − Cthousekeeping gene) control group. The relative expression of the target genes in the experimental treatment group (Q) was Q = 2−ΔΔCt. The means and DMRT (Duncan multiple range test) were evaluated by employing SPSS software (IBM, Armonk, NY, USA).

4. Conclusions

In conclusion, the Bm_nscaf2838_045 and Bm_nscaf2674_066 genes have similar performances. They were downregulated with individual BmRelish1 gene silence or DA treatment, and upregulated with BmRelish1 gene silence combined with DA treatment. Furthermore, the two genes were upregulated with individual BmRelish2 gene silence and downregulated with combination of BmRelish2 gene silence plus DA treatment, but their expression levels were not changed in BmRel gene silence combined with DA treatment. However, for the Bm_nscaf2767_133 gene, downregulated expression was found in individual BmRelish2 gene silence or DA treatment, and upregulated expressions were found in the combination of BmRelish2 gene silence and DA treatment, and in the individual BmRel or BmRelish1 silence. The results suggest that the gene expressions of Bm_nscaf2838_045 and Bm_nscaf2674_066 are closely related to the Imd signal pathway, but the Bm_nscaf2767_133 might be involved in both the Imd and Toll pathways. Furthermore, for both Bm_nscaf2838_045 and Bm_nscaf2674_066 gene expressions, the BmRelish1 may act as an activator, while BmRelish2 probably acts as a repressor. Meanwhile, the research results imply that DA may promote splicing BmRelish into the BmRelish2 as opposed to BmRelish1. Our research will provide new insight on the understanding of the activity mechanisms of destruxins.

Acknowledgments

This research was supported by the Guangzhou Science and Technology Program (2014Y2-00513) and the National Foundation of Natural Science of China (31272057).

Author Contributions

Weina Hu and Guangwei He completed RNAi experiments and wrote the MS, Jingjing Wang made the test of transcription factors by DA treatments. Qiongbo Hu designed the experiment and wrote and revised the MS.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kershaw, M.J.; Moorhouse, E.R.; Bateman, R.; Reynolds, S.E.; Charnley, A.K. The role of destruxins in the pathogenicity of Metarhizium anisopliae for three species of insect. J. Invertebr. Pathol. 1999, 74, 213–223. [Google Scholar] [CrossRef] [PubMed]
  2. Pedras, M.S.C.; Zaharia, L.I.; Ward, D.E. The destruxins: Synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 2002, 59, 579–596. [Google Scholar] [CrossRef]
  3. Liu, B.L.; Tzeng, Y.M. Development and applications of destruxins: A review. Biotechnol. Adv. 2012, 30, 1242–1254. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, X.R.; Hu, Q.B.; Yu, X.Q.; Ren, S.X. Effects of destruxins on free calcium and hydrogen ions in insect hemocytes. Insect Sci. 2014, 21, 31–38. [Google Scholar] [CrossRef] [PubMed]
  5. Vey, A.; Matha, V.; Dumas, C. Effects of the peptide mycotoxin destruxin E on insect haemocytes and on dynamics and efficiency of the multicellular immune reaction. J. Invertebr. Pathol. 2002, 80, 177–187. [Google Scholar] [CrossRef]
  6. Pal, S.; Leger, R.J.S.; Wu, L.P. Fungal peptide destruxin a plays a specific role in suppressing the innate immune response in Drosophila melanogaster. J. Biol. Chem. 2007, 282, 8969–8977. [Google Scholar] [CrossRef] [PubMed]
  7. He, G.W.; Hu, W.N.; Hu, Q.B. Toxicity of destruxins against four insect cell lines. Chin. J. Appl. Entomol. 2015, 52, 1466–1473. [Google Scholar]
  8. Gong, L.; Chen, X.R.; Liu, C.L.; Hu, Q.B. Gene expression profile of Bombyx mori hemocyte under the stress of destruxin A. PLoS ONE 2014, 9, e96170. [Google Scholar] [CrossRef] [PubMed]
  9. Zhang, M.M.; Chu, Y.; Zhao, Z.W.; An, C.J. Progress in the mechanisms of the innate immune responses in insects. Acta Entomol. Sinica 2012, 55, 1221–1229. [Google Scholar]
  10. Chu, Y.; Zhou, F.; Zhang, M.M.; An, C.J. Frontiers of research on the innate immune response in insects. Chin. J. Appl. Entomol. 2013, 50, 311–320. [Google Scholar]
  11. Tanaka, H.; Ishibashi, J.; Fujita, K.; Nakajima, Y.; Sagisaka, A.; Tomimoto, K.; Suzuki, N.; Yoshiyama, M.; Kaneko, Y.; Iwasaki, T.; et al. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori. Insect Biochem. Mol. Biol. 2008, 38, 1087–1110. [Google Scholar] [CrossRef] [PubMed]
  12. Suetsugu, Y.; Futahashi, R.; Kanamori, H.; Kadono-Okuda, K.; Sasanuma, S.; Narukawa, J.; Ajimura, M.; Namiki, N.; Shimomura, M.; Sezutsu, H.; et al. Large scale full-length cDNA sequencing reveals a unique genomic landscape in a Lepidopteran model insect, Bombyx mori. G3-Genes Genoms Genet. 2013, 3, 1481–1492. [Google Scholar] [CrossRef] [PubMed]
  13. Zoladek, T.; Vaduva, G.; Hunter, L.A.; Boguta, M.; Go, B.D.; Martin, N.C.; Hopper, A.K. Mutations altering the mitochondrial-cytoplasmic distribution of Mod5p implicate the actin cytoskeleton and mRNA 3’ ends and/or protein synthesis in mitochondrial delivery. Mol. Cell. Biol. 1995, 15, 6884–6894. [Google Scholar] [CrossRef] [PubMed]
  14. Tang, H.Y.; Cai, M. The EH-domain-containing protein Pan1 is required for normal organization of the actin cytoskeleton in Saccharomyces cerevisiae. Mol. Cell. Biol. 1996, 16, 4897–4914. [Google Scholar] [CrossRef] [PubMed]
  15. Kaminska, J.; Wysocka, K.M.; Smaczynska-de, R.I.; Rytka, J.; Żołądek, T. Pan1p, an actin cytoskeleton-associated protein, is required for growth of yeast on oleate medium. Exp. Cell Res. 2005, 310, 482–492. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, P. Serine Protease Inhibitors in the Silkworm Bombyx mori; Southwest University: Chongqing, China, 2008. [Google Scholar]
  17. Hedstrom, L. Serine protease mechanism and specificity. Chem. Rev. 2002, 102, 4501–4524. [Google Scholar] [CrossRef] [PubMed]
  18. Madala, P.K.; Tyndall, J.D.; Nall, T.; Fairlie, D.P. Update 1 of: Proteases universally recognize beta strands in their active sites. Chem. Rev. 2010, 110, PR1–PR31. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, Y. Construction and Analysis of Suppression Substractive Hybridization cDNA Library from Midguts of Bombyx mori Infected with Nosema bombycis; Chongqing Normal University: Chongqing, China, 2013. [Google Scholar]
  20. McNeil, M.; Darvill, A.G.; Fry, S.C.; Albersheim, P. Structure and function of primary cell walls of plants. Ann. Rev. Biochem. 1984, 53, 625–663. [Google Scholar] [CrossRef] [PubMed]
  21. Hu, Q.B.; Ren, S.X.; Wu, J.H.; Chang, J.M.; Musa, P.D. Investigation of destruxin A and B from 80 Metarhizium starins in China, and the optimization of cultural conditions for the strain MaQ10. Toxicon 2006, 48, 491–498. [Google Scholar] [CrossRef] [PubMed]
  22. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DELTADELTACT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  23. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 2002–2007. [Google Scholar] [CrossRef]
  • Sample Availability: Samples of the compound, destruxin A is available from the authors.
Figure 1. The gene expression levels of transcription factors after specific siRNA or DA treatments ((A) The gene expression levels after respectively treated with specific siRNA for 24 h; (B) The gene expression levels after 8 h of DA treatment; CK: control). The different letters on the columns indicate the significant difference (p < 0.05) by DMRT.
Figure 1. The gene expression levels of transcription factors after specific siRNA or DA treatments ((A) The gene expression levels after respectively treated with specific siRNA for 24 h; (B) The gene expression levels after 8 h of DA treatment; CK: control). The different letters on the columns indicate the significant difference (p < 0.05) by DMRT.
Molecules 22 00041 g001
Figure 2. Effect of DA and transcription factor RNAi on the gene expression profiles of Bm_nscaf2838_045 (A); Bm_nscaf2674_066 (B); Bm_nscaf2767_133 (C) (CK: control; DA: destruxin A treatment; BmRelish1/2: RNAi BmRlish1/2 gene; BmRel: RNAi BmRel gene; BmRelish1/2+DA: RNAi BmRlish1/2 gene combined with DA treatment; BmRel+DA: RNAi BmRel gene combined with DA treatment). The different letters on the columns indicate the significant difference (p < 0.05) by DMRT.
Figure 2. Effect of DA and transcription factor RNAi on the gene expression profiles of Bm_nscaf2838_045 (A); Bm_nscaf2674_066 (B); Bm_nscaf2767_133 (C) (CK: control; DA: destruxin A treatment; BmRelish1/2: RNAi BmRlish1/2 gene; BmRel: RNAi BmRel gene; BmRelish1/2+DA: RNAi BmRlish1/2 gene combined with DA treatment; BmRel+DA: RNAi BmRel gene combined with DA treatment). The different letters on the columns indicate the significant difference (p < 0.05) by DMRT.
Molecules 22 00041 g002
Table 1. Small interfering RNA (siRNA) for silencing target genes.
Table 1. Small interfering RNA (siRNA) for silencing target genes.
Target GenesiRNA Sequence
BmRel5’-GCAAACGAGACGAGACCUUTT-3’
3’-TTCGUUUGCUCUGCUCUGGAA-5’
BmRelish15’-GCAGUUCCCGAAUCUGCAATT-3’
3’-TTCGUCAAGGGCUUAGACGUU-5’
BmRelish25’-CCCAUUGAAAUGACUUGAATT-3’
3’-TTGGGUAACUUUACUGAACUU-5’
Table 2. Primers of the silkworm genes for qPCR detecting.
Table 2. Primers of the silkworm genes for qPCR detecting.
GenePrimer (5’→3’)
BmRelish1F: CCTGGAAAATGTCTGCCGATAA
R: ATGCCGTCTAGTGCCGTGCT
BmRelish2F: AGCAGTTATGCGTTTCGGTTTG
R: AATGCTGCCACCCACCTTG
BmRelF: AATGACCCCAATCAACCTAACG
R: CGGAATCTGAGGGCTTTGC
Bm_nscaf2838_045 (GeneBank access NO. KY379951)F: CCTGCCATTGTTGAAGGTGC
R: GAGGGTCTCGGGAAGAGTGA
Bm_nscaf2674_066 (GeneBank access NO. KY379952)F: GTGTATCTGACGGCAACCTC
R: ATGTCATTGGCATTGCTCTT
Bm_nscaf2767_133 (GeneBank access NO. KY379953)F: GTTGAGGACATTGCCGAAGA
R: ACCAACAATTACGGGCTTGA
GAPDH (reference gene)F: ATGTTTGTTGTGGGTGTTA
R:GTAGAGGCAGGAATGATT

Share and Cite

MDPI and ACS Style

Hu, W.; He, G.; Wang, J.; Hu, Q. The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm. Molecules 2017, 22, 41. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules22010041

AMA Style

Hu W, He G, Wang J, Hu Q. The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm. Molecules. 2017; 22(1):41. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules22010041

Chicago/Turabian Style

Hu, Weina, Guangwei He, Jingjing Wang, and Qiongbo Hu. 2017. "The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm" Molecules 22, no. 1: 41. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules22010041

Article Metrics

Back to TopTop